Cell senescence gene database Home
Cell senescence database
General information | Literature | Expression | Regulation | Mutation | Homolog | Interaction

Basic Information

Gene ID

728655

Name

HULC

Synonym

HCCAT1|LINC00078|NCRNA00078;hepatocellular carcinoma up-regulated long non-coding RNA;HULC;hepatocellular carcinoma up-regulated long non-coding RNA

Definition

hepatocellular carcinoma associated transcript 1 (non-protein coding)|highly up-regulated in liver cancer (non-protein coding)|highly up-regulated in liver cancer long non-coding RNA|long intergenic non-protein coding RNA 78

Position

6p24.3

Gene Type

ncRNA

External Links

Links to Entrez Gene

728655

Links to all GeneRIF Items

728655

Links to iHOP

728655

Sequence Information

Nucleotide Sequence

>728655 : length: 500
ATGGGGGTGGAACTCATGATGGAATTGGAGCCTTTACAAGGGAATGAAGAGACAAGAGCT
CTCTTTATGCCACGTGAGGATACAGCAAGGCCCCAATCTGCAAGCCAGGAAGAGTCGTCA
CGAGAACCAGACCATGCAGGAACTCTGATCGTGGACATTTCAACCTCCAGAACTGTGATC
CAAAATGCATATGTATCTTTGGAAGAAACTCTGAAGTAAAGGCCGGAATATTCTTTGTTT
AAAACATTAAAAACAAAACAGACCAAAGCATCAAGCAAGAAGTTTCCTGGCAATAAACTA
AGCACAGCATTATTTTTTAAGGAACACAAATTAAGTGTTCAACCTGTGGCAAATTTGTAC
TTTCTCCCTGAATTATGTTGTTATCAAAGAAAAAAATTGGGAAGCATGGCAAAATATCAT
CAAAACTGAAACTAGAATTAAACAAAACTAAATTAAAATGAAATAAAATGATGTCCATTC
TTAAAAAAAAAAAAAAAAAA

Protein Sequence

>728655 : length: 3
N/A



')